Review



ix71-f22fl/ph inverted fluorescence microscope (ifm  (Evident Corporation)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Evident Corporation ix71-f22fl/ph inverted fluorescence microscope (ifm
    Ix71 F22fl/Ph Inverted Fluorescence Microscope (Ifm, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/fluorescence+microscopy/pm39191034-104-6-11
    Average 90 stars, based on 1 article reviews
    ix71-f22fl/ph inverted fluorescence microscope (ifm - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Staining:

    Article Title: NOX4 promotes tumor progression through the MAPK-MEK1/2-ERK1/2 axis in colorectal cancer
    Article Snippet: Fluorescein isothiocyanate and Cy3-conjugated secondary antibodies (1:500, BioLegend) were used to detect the primary antibodies. .. The stained cells were counterstained with 4¢6-diamidino-2-phenylindole (1:1000; Roche, Basel, Switzerland) and analyzed using an IX71 inverted fluorescence microscope (model 1003; Olympus). ..

    Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE.
    Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using IX71 inverted fluorescence microscope (Olympus, Tokyo, Japan). .. To prepare live cells for fluorescence microscopy, cells were stained with 1 % (v/v) propidium iodide (PI, Sigma-Aldrich) and fluorescein diacetate (FDA, Sigma-Aldrich) for 5 min at 37 ◦C in the dark, or JC-1 (Mitochondrial Membrane Potential Assay Kit, Beyotime, Shanghai, China) for 20 min at 37 ◦C.

    Fluorescence:

    Article Title: NOX4 promotes tumor progression through the MAPK-MEK1/2-ERK1/2 axis in colorectal cancer
    Article Snippet: Fluorescein isothiocyanate and Cy3-conjugated secondary antibodies (1:500, BioLegend) were used to detect the primary antibodies. .. The stained cells were counterstained with 4¢6-diamidino-2-phenylindole (1:1000; Roche, Basel, Switzerland) and analyzed using an IX71 inverted fluorescence microscope (model 1003; Olympus). ..

    Article Title: Fluorescent Nanocable as a Biomedical Tool: Intracellular Self-Assembly Formed by a Natural Product Interconnects and Synchronizes Mitochondria.
    Article Snippet: Fluorescence spectra were obtained by using a Horiba Duetta spectrofluorometer with a 10 mm quartz cuvette. .. Fluorescence images were collected on an Olympus IX71 inverted fluorescence microscope or Zeiss LSM 880 confocal laser scanning microscope. ..

    Article Title: Proteomic analysis of the developing mammalian brain links PCDH19 to the Wnt/β-catenin signalling pathway.
    Article Snippet: The cryosections were washed three times with Wash Buffer and sealed with coverslips using ProLong Diamond Antifade Mountant with DAPI (Thermo Fisher). .. Slides were viewed at 20× magnification on Olympus IX71 inverted fluorescence microscope. .. Background fluorescence signal in each image was corrected using Fiji’s Process background function (NIH, USA) and then Costes automatic thresholding [18] was applied using the JACoP plugin for Fiji (https:// imagej.nih.gov/ij/plugins/track/jacop2.html).

    Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum
    Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus IX71 inverted fluorescence microscope fitted with a monochromator-based illumination system under the control of TillVision 4.0 software. ..

    Article Title: STIM1-dependent store-operated calcium entry mediates sex differences in macrophage chemotaxis and monocyte recruitment
    Article Snippet: The macrophage population within the SVF was then purified by immunomagnetic separation (EasySep Mouse CD11b Positive Selection Kit II; STEMCELL Technologies Inc) according to the manufacturer’s protocol. .. BMDMs suspended in complete media were seeded at 4.0 × 10 5 cells per well in a 24-well plate containing round 11 mm glass coverslips and allowed to adhere for at least 2 h. Cells were then loaded with 2 μM fura2-AM for 45 min at room temperature and the coverslip was mounted in a recording chamber and positioned on the stage of an IX71 inverted fluorescence microscope (Olympus Corp). .. A CCD-based imaging system running SimplePCI software (Hamamatsu Photonics) was used to record fura-2 fluorescence and the [Ca 2+ ] cyto reported as the ratio of background-corrected fluorescence intensity excited at 340 nm and 380 nm and collected at 510 nm.

    Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE.
    Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using IX71 inverted fluorescence microscope (Olympus, Tokyo, Japan). .. To prepare live cells for fluorescence microscopy, cells were stained with 1 % (v/v) propidium iodide (PI, Sigma-Aldrich) and fluorescein diacetate (FDA, Sigma-Aldrich) for 5 min at 37 ◦C in the dark, or JC-1 (Mitochondrial Membrane Potential Assay Kit, Beyotime, Shanghai, China) for 20 min at 37 ◦C.

    Article Title: Blockade of Ca V 3 calcium channels and induction of G 0 /G 1 cell cycle arrest in colon cancer cells by gossypol.
    Article Snippet: .. Epifluorescence images were acquired using an Olympus IX71 Inverted Fluorescence Microscope (Olympus, Center Valley, PA, USA). ..

    Microscopy:

    Article Title: NOX4 promotes tumor progression through the MAPK-MEK1/2-ERK1/2 axis in colorectal cancer
    Article Snippet: Fluorescein isothiocyanate and Cy3-conjugated secondary antibodies (1:500, BioLegend) were used to detect the primary antibodies. .. The stained cells were counterstained with 4¢6-diamidino-2-phenylindole (1:1000; Roche, Basel, Switzerland) and analyzed using an IX71 inverted fluorescence microscope (model 1003; Olympus). ..

    Article Title: Fluorescent Nanocable as a Biomedical Tool: Intracellular Self-Assembly Formed by a Natural Product Interconnects and Synchronizes Mitochondria.
    Article Snippet: Fluorescence spectra were obtained by using a Horiba Duetta spectrofluorometer with a 10 mm quartz cuvette. .. Fluorescence images were collected on an Olympus IX71 inverted fluorescence microscope or Zeiss LSM 880 confocal laser scanning microscope. ..

    Article Title: Proteomic analysis of the developing mammalian brain links PCDH19 to the Wnt/β-catenin signalling pathway.
    Article Snippet: The cryosections were washed three times with Wash Buffer and sealed with coverslips using ProLong Diamond Antifade Mountant with DAPI (Thermo Fisher). .. Slides were viewed at 20× magnification on Olympus IX71 inverted fluorescence microscope. .. Background fluorescence signal in each image was corrected using Fiji’s Process background function (NIH, USA) and then Costes automatic thresholding [18] was applied using the JACoP plugin for Fiji (https:// imagej.nih.gov/ij/plugins/track/jacop2.html).

    Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum
    Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus IX71 inverted fluorescence microscope fitted with a monochromator-based illumination system under the control of TillVision 4.0 software. ..

    Article Title: STIM1-dependent store-operated calcium entry mediates sex differences in macrophage chemotaxis and monocyte recruitment
    Article Snippet: The macrophage population within the SVF was then purified by immunomagnetic separation (EasySep Mouse CD11b Positive Selection Kit II; STEMCELL Technologies Inc) according to the manufacturer’s protocol. .. BMDMs suspended in complete media were seeded at 4.0 × 10 5 cells per well in a 24-well plate containing round 11 mm glass coverslips and allowed to adhere for at least 2 h. Cells were then loaded with 2 μM fura2-AM for 45 min at room temperature and the coverslip was mounted in a recording chamber and positioned on the stage of an IX71 inverted fluorescence microscope (Olympus Corp). .. A CCD-based imaging system running SimplePCI software (Hamamatsu Photonics) was used to record fura-2 fluorescence and the [Ca 2+ ] cyto reported as the ratio of background-corrected fluorescence intensity excited at 340 nm and 380 nm and collected at 510 nm.

    Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE.
    Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using IX71 inverted fluorescence microscope (Olympus, Tokyo, Japan). .. To prepare live cells for fluorescence microscopy, cells were stained with 1 % (v/v) propidium iodide (PI, Sigma-Aldrich) and fluorescein diacetate (FDA, Sigma-Aldrich) for 5 min at 37 ◦C in the dark, or JC-1 (Mitochondrial Membrane Potential Assay Kit, Beyotime, Shanghai, China) for 20 min at 37 ◦C.

    Article Title: Blockade of Ca V 3 calcium channels and induction of G 0 /G 1 cell cycle arrest in colon cancer cells by gossypol.
    Article Snippet: .. Epifluorescence images were acquired using an Olympus IX71 Inverted Fluorescence Microscope (Olympus, Center Valley, PA, USA). ..

    Laser-Scanning Microscopy:

    Article Title: Fluorescent Nanocable as a Biomedical Tool: Intracellular Self-Assembly Formed by a Natural Product Interconnects and Synchronizes Mitochondria.
    Article Snippet: Fluorescence spectra were obtained by using a Horiba Duetta spectrofluorometer with a 10 mm quartz cuvette. .. Fluorescence images were collected on an Olympus IX71 inverted fluorescence microscope or Zeiss LSM 880 confocal laser scanning microscope. ..

    Control:

    Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum
    Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus IX71 inverted fluorescence microscope fitted with a monochromator-based illumination system under the control of TillVision 4.0 software. ..

    Software:

    Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum
    Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus IX71 inverted fluorescence microscope fitted with a monochromator-based illumination system under the control of TillVision 4.0 software. ..

    Immunofluorescence:

    Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE.
    Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using IX71 inverted fluorescence microscope (Olympus, Tokyo, Japan). .. To prepare live cells for fluorescence microscopy, cells were stained with 1 % (v/v) propidium iodide (PI, Sigma-Aldrich) and fluorescein diacetate (FDA, Sigma-Aldrich) for 5 min at 37 ◦C in the dark, or JC-1 (Mitochondrial Membrane Potential Assay Kit, Beyotime, Shanghai, China) for 20 min at 37 ◦C.

    other:

    Article Title: A TNIP1-driven systemic autoimmune disorder with elevated IgG4.
    Article Snippet: TNIP1 guide RNA 5′-GAAGCAGCAGTATGAGCCAGA-3′, single-stranded oligonucleotide 5′- TTCTAACCCCAGTACCTGTCTGCCCACAGCTGCTGGAAGTGAACAAGCAGTGGGACCAGCATTTCCGGTCCATGAAGCAGCAGTATGAGCCGAAGGTGATGGAGTTCCCGGGAGCTGAGCCGAGGACGGCTCGGGGAGGCGGGCTGAGAGGCTTGTGACCTGGCTGAGATGGGGACGGTGG-3′ and Cas9 protein were obtained from Integrated DNA Technologies.



    Similar Products

    86
    Olympus ix71 inverted fluorescence microscope 8
    Ix71 Inverted Fluorescence Microscope 8, supplied by Olympus, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/pm41311095-111-12-11
    Average 86 stars, based on 1 article reviews
    ix71 inverted fluorescence microscope 8 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    98
    Olympus ix71 inverted fluorescent microscope
    Ix71 Inverted Fluorescent Microscope, supplied by Olympus, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/DP74+Microscope+Digital+Camera/pmc12342706-516-16-15
    Average 98 stars, based on 1 article reviews
    ix71 inverted fluorescent microscope - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    90
    Evident Corporation ix71-f22fl/ph inverted fluorescence microscope (ifm
    Ix71 F22fl/Ph Inverted Fluorescence Microscope (Ifm, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/fluorescence+microscopy/pm39191034-104-6-11
    Average 90 stars, based on 1 article reviews
    ix71-f22fl/ph inverted fluorescence microscope (ifm - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Danaher Inc ix71 inverted fluorescent microscope
    Quantification of platelets coverage on the biomaterial surfaces at different incubation times. After testing, the material samples were stained for <t>fluorescent</t> microscopy analysis and imaged using an Olympus <t>IX71</t> inverted fluorescent <t>microscope</t> (Leica Microsystems, Germany). The raw images were then processed in Fiji (NIH, United States of America) to quantify the percentage of the image area covered by platelets using a custom script. Asterisks denote statistical significance between two-time intervals ( p < 0.01 = **).
    Ix71 Inverted Fluorescent Microscope, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/pmc11349534-80-9-13
    Average 86 stars, based on 1 article reviews
    ix71 inverted fluorescent microscope - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Evident Corporation ix71 inverted fluorescence microscope
    Quantification of platelets coverage on the biomaterial surfaces at different incubation times. After testing, the material samples were stained for <t>fluorescent</t> microscopy analysis and imaged using an Olympus <t>IX71</t> inverted fluorescent <t>microscope</t> (Leica Microsystems, Germany). The raw images were then processed in Fiji (NIH, United States of America) to quantify the percentage of the image area covered by platelets using a custom script. Asterisks denote statistical significance between two-time intervals ( p < 0.01 = **).
    Ix71 Inverted Fluorescence Microscope, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/bx51+microscope/pm39080909-155-7-6
    Average 90 stars, based on 1 article reviews
    ix71 inverted fluorescence microscope - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Evident Corporation inverted fluorescence microscope ix71
    Quantification of platelets coverage on the biomaterial surfaces at different incubation times. After testing, the material samples were stained for <t>fluorescent</t> microscopy analysis and imaged using an Olympus <t>IX71</t> inverted fluorescent <t>microscope</t> (Leica Microsystems, Germany). The raw images were then processed in Fiji (NIH, United States of America) to quantify the percentage of the image area covered by platelets using a custom script. Asterisks denote statistical significance between two-time intervals ( p < 0.01 = **).
    Inverted Fluorescence Microscope Ix71, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/bx51+microscope/bio_rxiv__2024__08__05__606632-250-8-11
    Average 90 stars, based on 1 article reviews
    inverted fluorescence microscope ix71 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Evident Corporation ix71, inverted fluorescence microscope
    Quantification of platelets coverage on the biomaterial surfaces at different incubation times. After testing, the material samples were stained for <t>fluorescent</t> microscopy analysis and imaged using an Olympus <t>IX71</t> inverted fluorescent <t>microscope</t> (Leica Microsystems, Germany). The raw images were then processed in Fiji (NIH, United States of America) to quantify the percentage of the image area covered by platelets using a custom script. Asterisks denote statistical significance between two-time intervals ( p < 0.01 = **).
    Ix71, Inverted Fluorescence Microscope, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/bx51+microscope/pmc11259065-102-9-6
    Average 90 stars, based on 1 article reviews
    ix71, inverted fluorescence microscope - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Quantification of platelets coverage on the biomaterial surfaces at different incubation times. After testing, the material samples were stained for fluorescent microscopy analysis and imaged using an Olympus IX71 inverted fluorescent microscope (Leica Microsystems, Germany). The raw images were then processed in Fiji (NIH, United States of America) to quantify the percentage of the image area covered by platelets using a custom script. Asterisks denote statistical significance between two-time intervals ( p < 0.01 = **).

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Characterizing thrombus adhesion strength on common cardiovascular device materials

    doi: 10.3389/fbioe.2024.1438359

    Figure Lengend Snippet: Quantification of platelets coverage on the biomaterial surfaces at different incubation times. After testing, the material samples were stained for fluorescent microscopy analysis and imaged using an Olympus IX71 inverted fluorescent microscope (Leica Microsystems, Germany). The raw images were then processed in Fiji (NIH, United States of America) to quantify the percentage of the image area covered by platelets using a custom script. Asterisks denote statistical significance between two-time intervals ( p < 0.01 = **).

    Article Snippet: After staining, the samples were imaged using an Olympus IX71 inverted fluorescent microscope (Leica Microsystems, Germany).

    Techniques: Incubation, Staining, Microscopy

    Box charts showing the percentage of (A) fibrin, (B) platelets, and (C) RBCs in clots incubated on different surfaces at different incubation times. After testing, the clots were fixed in 4% PFA for the histology analysis following the Carstairs protocol and imaged using a fluorescent microscope (Olympus, Tokyo, Japan. The figure shows the distribution of clot components obtained after processing the raw images using a custom MATLAB script. Asterisks denote statistical significance ( p < 0.05 and p < 0.01 = **).

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Characterizing thrombus adhesion strength on common cardiovascular device materials

    doi: 10.3389/fbioe.2024.1438359

    Figure Lengend Snippet: Box charts showing the percentage of (A) fibrin, (B) platelets, and (C) RBCs in clots incubated on different surfaces at different incubation times. After testing, the clots were fixed in 4% PFA for the histology analysis following the Carstairs protocol and imaged using a fluorescent microscope (Olympus, Tokyo, Japan. The figure shows the distribution of clot components obtained after processing the raw images using a custom MATLAB script. Asterisks denote statistical significance ( p < 0.05 and p < 0.01 = **).

    Article Snippet: After staining, the samples were imaged using an Olympus IX71 inverted fluorescent microscope (Leica Microsystems, Germany).

    Techniques: Incubation, Microscopy