ix71-f22fl/ph inverted fluorescence microscope (ifm (Evident Corporation)
Structured Review
Ix71 F22fl/Ph Inverted Fluorescence Microscope (Ifm, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ix71+inverted+fluorescence+microscope/fluorescence+microscopy/pm39191034-104-6-11
Average 90 stars, based on 1 article reviews
Images
Related Articles
Staining:Article Title: NOX4 promotes tumor progression through the MAPK-MEK1/2-ERK1/2 axis in colorectal cancer Article Snippet: Fluorescein isothiocyanate and Cy3-conjugated secondary antibodies (1:500, BioLegend) were used to detect the primary antibodies. .. The stained cells were counterstained with 4¢6-diamidino-2-phenylindole (1:1000; Roche, Basel, Switzerland) and analyzed using an Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE. Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using Fluorescence:Article Title: NOX4 promotes tumor progression through the MAPK-MEK1/2-ERK1/2 axis in colorectal cancer Article Snippet: Fluorescein isothiocyanate and Cy3-conjugated secondary antibodies (1:500, BioLegend) were used to detect the primary antibodies. .. The stained cells were counterstained with 4¢6-diamidino-2-phenylindole (1:1000; Roche, Basel, Switzerland) and analyzed using an Article Title: Fluorescent Nanocable as a Biomedical Tool: Intracellular Self-Assembly Formed by a Natural Product Interconnects and Synchronizes Mitochondria. Article Snippet: Fluorescence spectra were obtained by using a Horiba Duetta spectrofluorometer with a 10 mm quartz cuvette. .. Fluorescence images were collected on an Olympus Article Title: Proteomic analysis of the developing mammalian brain links PCDH19 to the Wnt/β-catenin signalling pathway. Article Snippet: The cryosections were washed three times with Wash Buffer and sealed with coverslips using ProLong Diamond Antifade Mountant with DAPI (Thermo Fisher). .. Slides were viewed at 20× magnification on Olympus Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus Article Title: STIM1-dependent store-operated calcium entry mediates sex differences in macrophage chemotaxis and monocyte recruitment Article Snippet: The macrophage population within the SVF was then purified by immunomagnetic separation (EasySep Mouse CD11b Positive Selection Kit II; STEMCELL Technologies Inc) according to the manufacturer’s protocol. .. BMDMs suspended in complete media were seeded at 4.0 × 10 5 cells per well in a 24-well plate containing round 11 mm glass coverslips and allowed to adhere for at least 2 h. Cells were then loaded with 2 μM fura2-AM for 45 min at room temperature and the coverslip was mounted in a recording chamber and positioned on the stage of an Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE. Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using Article Title: Blockade of Ca V 3 calcium channels and induction of G 0 /G 1 cell cycle arrest in colon cancer cells by gossypol. Article Snippet: .. Epifluorescence images were acquired using an Olympus Microscopy:Article Title: NOX4 promotes tumor progression through the MAPK-MEK1/2-ERK1/2 axis in colorectal cancer Article Snippet: Fluorescein isothiocyanate and Cy3-conjugated secondary antibodies (1:500, BioLegend) were used to detect the primary antibodies. .. The stained cells were counterstained with 4¢6-diamidino-2-phenylindole (1:1000; Roche, Basel, Switzerland) and analyzed using an Article Title: Fluorescent Nanocable as a Biomedical Tool: Intracellular Self-Assembly Formed by a Natural Product Interconnects and Synchronizes Mitochondria. Article Snippet: Fluorescence spectra were obtained by using a Horiba Duetta spectrofluorometer with a 10 mm quartz cuvette. .. Fluorescence images were collected on an Olympus Article Title: Proteomic analysis of the developing mammalian brain links PCDH19 to the Wnt/β-catenin signalling pathway. Article Snippet: The cryosections were washed three times with Wash Buffer and sealed with coverslips using ProLong Diamond Antifade Mountant with DAPI (Thermo Fisher). .. Slides were viewed at 20× magnification on Olympus Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus Article Title: STIM1-dependent store-operated calcium entry mediates sex differences in macrophage chemotaxis and monocyte recruitment Article Snippet: The macrophage population within the SVF was then purified by immunomagnetic separation (EasySep Mouse CD11b Positive Selection Kit II; STEMCELL Technologies Inc) according to the manufacturer’s protocol. .. BMDMs suspended in complete media were seeded at 4.0 × 10 5 cells per well in a 24-well plate containing round 11 mm glass coverslips and allowed to adhere for at least 2 h. Cells were then loaded with 2 μM fura2-AM for 45 min at room temperature and the coverslip was mounted in a recording chamber and positioned on the stage of an Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE. Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using Article Title: Blockade of Ca V 3 calcium channels and induction of G 0 /G 1 cell cycle arrest in colon cancer cells by gossypol. Article Snippet: .. Epifluorescence images were acquired using an Olympus Laser-Scanning Microscopy:Article Title: Fluorescent Nanocable as a Biomedical Tool: Intracellular Self-Assembly Formed by a Natural Product Interconnects and Synchronizes Mitochondria. Article Snippet: Fluorescence spectra were obtained by using a Horiba Duetta spectrofluorometer with a 10 mm quartz cuvette. .. Fluorescence images were collected on an Olympus Control:Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus Software:Article Title: Two-pore channel-2 and inositol trisphosphate receptors coordinate Ca 2+ signals between lysosomes and the endoplasmic reticulum Article Snippet: .. For other Fura-2 measurements ( , , , , and ), images were captured with a cooled coupled device camera (TILL photonics) attached to an Olympus Immunofluorescence:Article Title: Oleanolic acid alleviating ischemia-reperfusion injury in rat severe steatotic liver via KEAP1/NRF2/ARE. Article Snippet: .. Immunofluorescence samples and live cells stained with different fluorescence dyes were visualized using other:Article Title: A TNIP1-driven systemic autoimmune disorder with elevated IgG4. Article Snippet: TNIP1 guide RNA 5′-GAAGCAGCAGTATGAGCCAGA-3′, single-stranded oligonucleotide 5′- TTCTAACCCCAGTACCTGTCTGCCCACAGCTGCTGGAAGTGAACAAGCAGTGGGACCAGCATTTCCGGTCCATGAAGCAGCAGTATGAGCCGAAGGTGATGGAGTTCCCGGGAGCTGAGCCGAGGACGGCTCGGGGAGGCGGGCTGAGAGGCTTGTGACCTGGCTGAGATGGGGACGGTGG-3′ and Cas9 protein were obtained from Integrated DNA Technologies. |
